A: The factory-built controls from our standard factory layout can be used as spiking probes, providing that they do not            cross-hybridize with your material. The sequences of these probes are shown in Table 1. You can order oligonucleotides that are            reverse-complimentary to the selected control probes, and get them end-labeled (biotin or fluorescent dye, should be the same            labeling as in the planned experiments). Two or three of these oligonucleotides would be sufficient as spiking controls to add to            the hybridization mixture. Phage lambda spiking controls could be prepared and used with the NC probes named ‘NC-SP-phage’            that are included in the standard factory layout. Preparation of lambda spiking controls from commercial phage lambda DNA            includes several steps: PCR amplification of lambda DNA fragments, cloning into a vector containing the T7 RNA-polymerase            promoter, sequencing of the cloned fragments, in vitro transcription, and quality control of the resultant RNA. You can also use            commercially available Stratagene spiking control mRNA samples made from 7 Arabidopsis thaliana genes. Typically two or three            spiking controls should be sufficient. You need to select them and include the corresponding probes from the following list into            your array design files.

           LTR4: acgacatcatttgcctgaagagtatggtttcgtatacg__#AF159801

           LTR6: caacacggtgattgcggatctttacccttgcttat__#AF159803

           PRKase: gatttcccgggtagcaacaacggtactggtctttt__#X58149

           RCA: cgtatcggtgtctgcaagggtatcttcagaactga__#X14212

           XCP2: ggttacatcaggctgaagaggaacactgggaaacc__#AF191028

           TIM: gctgcttgattgagaactatcagtaacggaaatcgct__#AF247559

           RCP1: tgaatgaatgtacacgccataaacgccctttgttca__#AF168390

           Please note that these controls would cross-hybridize if you work with plant material.

       A: Negative control probes are usually used to calculate background for subtraction. The area surrounding spots and no synthesis            spots cannot be used for background calculation because they give an over-estimation of background. You can use factory-built            probes (both negative, NC, and quality controls, QC) as negative controls, providing that they do not cross-hybridize with your            material. The NC probes labeled "plant," "bacteria," and "phage" are derived from Arabidopsis thaliana, Agrobacterium tumifaciens,            and phage lambda, respectively. If you work with any of these organisms, you may need to provide your own set of negative            controls for probe design.

           Plotting the distribution of NC spot intensities can show how well particular NC probes perform in the context of you array. For            background subtraction, we suggest to use only NC probes with low intensities (lowest 5-30%). If your arrays do not have an            appropriate set of negative controls with low signal intensities, it might be better to omit the background subtraction step from            data analysis.

       A: We do not recommend it for gene expression studies in eukaryotic organisms, because the standard mRNA amplification methods            (based on oligo(dT) primers) should dramatically reduce the proportion of rRNA in the sample. This reduction may be non-uniform            for different samples, different amplification reactions, and different inputs of total RNA. Variable results of this selection against            rRNA make it a poor control for array data normalization.